Mm/Hs_MAPK1 Control siRNA
Print
For a positive control knockdown in siRNA experiments
siRNA control for human or mouse mitogen-activated protein kinase-1.
- Buy Products
- Product Details
Buy Products
Cat No./ID:1022564 Mm/Hs_MAPK1 control siRNA (5 nmol) $204.00 Mm/Hs_MAPK1 control siRNA (5 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957) |
Cat No./ID:1027321 Mm/Hs_MAPK1 control siRNA (20 nmol) $315.00 Mm/Hs_MAPK1 control siRNA (20 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957) |
The Mm/Hs_MAPK1 Control siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
Product Details
Principle
siRNA type | Control |
Sense sequence | UGCUGACUCCAAAGCUCUGdTdT |
Antisense sequence | CAGAGCUUUGGAGUCAGCAdTdT |
Target DNA sequence | AATGCTGACTCCAAAGCTCTG |
Dye label/detection | – |
Product Resources
Customers who bought these products also bought
- Cat No./ID:1027298
AllStars Hs Cell Death siRNA (5 nmol)
Positive cell death phenotype control, 5 nmol$204.00Add To Cart - Cat No./ID:204243
QuantiTect SYBR Green RT-PCR Kit (200)
For 200 x 50 µl reactions: 3 x 1.7 ml 2x QuantiTect SYBR Green RT-PCR Master Mix, 100 µl QuantiTect RT Mix, 2 x 2 ml RNase-Free Water$932.00Add To Cart - Cat No./ID:1027416
FlexiTube GeneSolution
siRNA GeneSolution detailsSelect Targets - Cat No./ID:1027281
AllStars Neg. Control siRNA (20 nmol)
Thoroughly tested and validated nonsilencing siRNA$315.00Add To Cart - Cat No./ID:1027280
AllStars Negative Control siRNA (5 nmol)
Thoroughly tested and validated nonsilencing siRNA$204.00Add To Cart - Cat No./ID:301705
HiPerFect Transfection Reagent (1 ml)
HiPerFect Transfection Reagent for up to 333 transfections in 24-well plates or up to 1333 transfections in 96-well plates$404.00Add To Cart - Cat No./ID:1022076
Negative Control siRNA (5 nmol)
Negative control siRNA (5 nmol)$180.00Add To Cart - Cat No./ID:1027415
FlexiTube siRNA (1 nmol)
1 nmol siRNA delivered in tubesSelect Targets - Cat No./ID:330522
RT² SYBR Green ROX qPCR Mastermix (12)
Contains 12 x 1.35 ml tubes: for 12 x 96-well RT² PCR Arrays, 8 x 384-well RT² PCR Arrays or 1200 x 25 µl reactionsor 3000 x 10 µl reactions$1,128.00Add To Cart - Cat No./ID:330401
RT2 First Strand Kit (12)
Fortwelve 20 µl first strand cDNA synthesis reactions; Buffer GE (24 µl), 5x Buffer BC3 (48 µl), RE3 Reverse Transcriptase Mix (24 µl), Control P2 (12 µl), Nuclease-Free Water (1 ml)$248.00Add To Cart